Skip to main content

Advertisement

Table 1 Gene-specific primers used to amplify the miRNAs

From: PLGA-based gene delivering nanoparticle enhance suppression effect of miRNA in HePG2 cells

Gene Forward primer (5' → 3') Reverse primer (5' → 3')
RT-miR-26a CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCCTATC  
miR-26a ACACTCCAGCTGGGTTCAAGTAATCCAGGA TGGTGTCGTGGAGTC
U6 GCTTCGGCAGCACATATACTAAAAT CGCTTCACGAATTTGCGTGTCAT