Skip to main content

Table 1 Primer sequences for the investigated genes

From: Silver nanoparticles administered to chicken affect VEGFA and FGF2 gene expression in breast muscle and heart

Gene symbol Gene IDa Size (bp) Primer sequence (5’ to 3’)
ACTB 396526 ca. 169 forward: GTCCACCTTCCAGCAGATGT
reverse: ATAAAGCCATGCCAATCTCG
EEF1A2 419244 ca. 85 forward: AGCAGACTTTGTGACCTTGCC
reverse: TGACATGAGACAGACGGTTGC
FGF2 396413 ca. 151 forward: GGCACTGAAATGTGCAACAG
reverse: TCCAGGTCCAGTTTTTGGTC
VEGFA 395909 ca. 194 forward: TGAGGGCCTAGAATGTGTCC
    reverse: TCTTTTGACCCTTCCCCTTT
  1. aNCBI resources.