Skip to main content

Table 1 Primers used in real-time qPCR analyses

From: Molecular response of Escherichia coli adhering onto nanoscale topography

Gene name Primer forward Codified protein GenInfo identifier
Primer reverse
gapA TTGGCCGTATCGGTCGCATT Glyceraldehyde-3-phosphate dehydrogenase A 16129733
ompC TAACGGCGACCGTGCTGAAA Outer membrane porinprotein C 16130152
luxS ACCGTGTTCGATCTGCGCTT S-ribosylhomocysteinelyase 16130599
murA AACGAAGCTCCAGGGCGAAG UDP-N-acetylglucosamine 1-carboxyvinyltransferase 16131079
fliC CAGTTCTCCAACCGCGGTCA Flagellar filament structural protein (flagellin) 16129870
lpxC GCAACCAGCGCTATGCGATG UDP-3-O-acyl N-acetylglucosaminedeacetylase 16128089
slp CCGACTGCTCGCCAGACAAA Outer membrane lipoprotein 90111603
flu TGCCGGCACGGTCCGGGATGA CP4-44 prophage; antigen 43 (Ag43) phase-variable biofilm formation autotransporter 49176177
cpxP GGCCCGGCACGAACAGCCTCCT Periplasmic adaptor protein 49176443
dsbA CACAAGGCCGGGGCGCGTGG Oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I 49176085
degP GCGCTGGGGCGTAGCGGCCT Serine endoprotease (protease Do), membrane-associated 16128154
cpxR TCTGGCTGACGCTGGCGCTGGT Sensory histidine kinase/signal sensing protein 16129840
fimE GTTACGGGGCAACGGGAGCC Tyrosine recombinase/inversion of on/off regulator of fimA 16132134