Skip to main content

Table 1 Primer sequences for the analysed genes in J774A.1 cells

From: AMP-Conjugated Quantum Dots: Low Immunotoxicity Both In Vitro and In Vivo

Gene Forward (5′-3′) Reverse (5′-3′)
β-actin TTCTTTGCAGCTCCTTCG TCGTCGCCCGCGAAGCC
TLR-2 GTCGTTCAAGGAGGTGCG TGAGGTTTCGGTAAGTTGT
TLR-3 GGAGCCAGAACTGTGCCAAATACTC TCGCAACGCAAGGATTTTATTTTTT
TLR-4 TCTGGTGGCTGTGGAGAC TTGTGAGCCACATTGAGT
TLR-5 TGGGGACCCAGTATGCTAACT CCACAGGAAAACAGCCGAAGT
TLR-7 CTTACCCTTACCATCAAC TTGGACCCCAGTAGAAC
TLR-9 CGGGAACTGCTACTACAAGA GGTTGTTATACTTCAGAGAC
MyD88 ACTCGCAGTTTGTTGGATG TGTAAAGGCTTCTCGGACT
NF-κB TTCCAGGTGACAGTGCGG GAGTTCCGGTTTACTCGG
I-κB GCCCTTCCTCCCTAACTG GGGTAGCGAACTTGAAAAC
TNF-α TCTCATTCCTGCTTGTGG GAGGGTCTGGGCCATAGA
IL-1β TCGTGCTGTCGGACCCAT TCCTTTGAGGCCCAAGGCCA
TGF-β CTC TCCACCTGCAAGACCAT CTGCCGTACAATTCCAGTGA
MCP-1 TGAGGTGGTTGTGGAAAAGG CCTGCTGTTCACAGTTGCC