Skip to main content

Table 1 Primer sequence

From: Restored microRNA-133a-3p or Depleted PSAT1 Restrains Endothelial Cell Damage-Induced Intracranial Aneurysm Via Suppressing the GSK3β/β-Catenin Pathway

Gene Sequence (5′→3′)
miR-133a-3p F: UUUGGUCCCCUUCAACCAGCUG
R: UAAACCAAGGUAAAAUGGUCGA
PSAT1 F: GGCCAGTTCAGTGCTGTCC
R: GCTCCTGTCACCACATAGTCA
GSK3β F: ATTCCCTCAAATTAAGGCACATCC
R: ATACTCCAGCAGACGGCTACACAG
Bax F: CCCACCAGCTCTGAACAGTTC
R: CCAGCCACAAAGATGGTCAC
Bcl-2 F: CTTCGCCGAGATGTCCAG
R: GGCTCAGATAGGCACCCA
Ki-67 F: GAGAATCTGTGAATCTGGGTAA
R: CAGGCTTGCTGAGGGAAT
CyclinD1 F: GGTTTCATCCAGGATCGAGCAGG
R: ACAAAGATGGTCACGGTCTGCC
β-catenin F: CTTTTGTCGTTGGAGATGAC
R: TGCCAAGTGGGTGGTATAGAGG
GAPDH F: GAAATCCCATCACCATCTTCCAGG
R: GAGCCCCAGCCTTCTCCATG
U6 F: CTCGCTTCGGCAGCACA
R: AACGCTTCACGAATTTGCGT
  1. Note: F forward, R reverse, miR-133a-3p microRNA-133a-3p, PSAT1 phosphoserine aminotransferase 1, GSK3β glycogen synthase kinase 3β, GAPDH glyceraldehyde phosphate dehydrogenase