Skip to main content

Table 1 Primer sequence

From: M1 Macrophage-Derived Exosomal MicroRNA-326 Suppresses Hepatocellular Carcinoma Cell Progression Via Mediating NF-κB Signaling Pathway

Gene Sequence (5′–3′)
IDO1 F: TATTTGTCTGGCTGGAAAGGC
R: GGAGGAACTGAGCAGCATGTC
IL-12p35 F: GATGGCCCTGTGCCTTAGTA
R: TCAAGGGAGGATTTTTGTGG
miR-326 F: ACTGTCCTTCCCTCTGGGC
R: AATGGTTGTTCTCCACTCTCTCTC
CD206 F: AAAACTGACTGGGCTTCCGT
R: CCTCTCGAGCACAGGTCATC
CD68 F: GCTTTGCAATCTCCCTGTTG
R: TTGATCCGGGGGTTCTTACCTG
NF-κB F: GAAATTCCTGATCCAGACAAAAAC
R: ATCACTTCAATGGCCTCTGTGTAG
U6 F: ATTGGAACGATACAGAGAAGATT
R: GGAACGCTTCACGAATTTG
GAPDH F: AGAACATCATCCCTGCCTCTACT
R: GATGTCATCATATTTGGCAGGT
  1. F, forward; R, reverse; IDO1, indoleamine 2,3-dioxygenase 1; IL-12p35, interleukin-12p35; miR-326, microRNA-326; NF-κB, nuclear factor κB; GAPDH, glyceraldehyde phosphate dehydrogenase