Skip to main content

Table 1 Primers used for real-time RT-PCR

From: Potential Osteoinductive Effects of Hydroxyapatite Nanoparticles on Mesenchymal Stem Cells by Endothelial Cell Interaction

Target gene Forward primer sequence (5′–3′) Reverse primer sequence (5′–3′)
RUNX-2 TGGTTACTGTCATGGCGGGTA TCTCAGATCGTTGAACCTTGCTA
Col I TGGTGGAGCAGCAAGAGCAA CAGTGGACAGTAGACGGAGGAAA
OCN CACTCCTCGCCCTATTGGC CCCTCCTGCTTGGACACAAAG
GAPDH CTGGTAAAGTGGATATTGTTGCCAT TGGAATCATATTGGAACATGTAAACC
ALP GGACATGCAGTACGAGCTGA GTCAATTCTGCCTCCTTCCA
NANOG CAGAAGGCCTCAGCACCTAC ATTGTTCCAGGTCTGGTTGC
OCT3/4 GTGGAGAGCAACTCCGATG TGCAGAGCTTTGATGTCCTG
SOX2 CCAAGACGCTCATGAAGAAG TGGTCATGGAGTTGTACTGC
GAPDH CTGGTAAAGTGGATATTGTTGCCAT TGGAATCATATTGGAACATGTAAACC
  1. RUNX-2 runt-related transcription factor 2, Col I type I collagen, OCN osteocalcin, ALP alkaline phosphatase, SOX 2 SRY-related HMG-box 2