Skip to main content

Table 1 Primers used for quantitative reverse transcription polymerase chain reaction

From: Black Phosphorus Nanoparticles Promote Osteogenic Differentiation of EMSCs Through Upregulated TG2 Expression

Gene Forward primer sequence (5–3) Reverse primer sequence (5–3)
RUNX2 TCATGGCCGGGAATGATGAG CGCTCCGGCCTACAAATCTC
TG2 CTCAATTGGCATCAAAAAGGGC AGCCTCCTTCCTTTGGTAGC
OPN TGTGAAACTCGTGGCTCTGA GAACCAAGCGTGGAAACACA
OCN ACAGTGACCTGAGTGAGGGT GGGACTCCTGGCTGTTCATC
BMP-2 CGTTGATCAAATCAGAAGCCAT AGCTCCGCAGATGTGAGAAA
COL-1 CCTGGTGCTGATGGACAACC TTTTAGCCCAAGGGTGAAGGG
GAPDH ACATTGGGGGTAGGAACACG GCCATCACTGCCACTCAGAA