Skip to main content

Table 1 Oligonucleotide sequences

From: Synapsable quadruplex-mediated fibers

Name Length 5′→3′ sequence ε 260 a
(L mol−1m−1)
ϵ 260
    (L mol−1m−1) (mM−1cm−1)
C1A 39 ACAGTAGAGATGCTGCTGATTCGTTCATGTGCTTCAAGC 3.732 × 107 373.2
C1B TGTCATCTCTACGACGACTAAGCAAGTACACGAAGTTCG 3.769 × 107 376.9
SQ1A 39 CAGTAGAGATGCTGCTGAGGGGGGGG TGTGCTTCAAGCG 3.799 × 107 379.9
SQ1B CTCTACGACGACTGGGGGGGG ACACGAAGTTCGCTACTG 3.732 × 107 373.2
C2 29 TCTACGACGACTGGGGGGGG ACACGAAGT 2.856 × 107 285.6
  1. The G-box region in each sequence is underlined. aExtinction coefficients for single-stranded oligonucleotide in SI units.