Skip to main content

Table 1 Sequence of each single-strand DNA and RNA

From: Gint4.T-Modified DNA Tetrahedrons Loaded with Doxorubicin Inhibits Glioma Cell Proliferation by Targeting PDGFRβ

ssDNA DNA and RNA Sequence (5′→3′)
S1 ACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA
S1’ TTTTTTACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA
S2 TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC
S3 TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC
S4 TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT
cy3-S2 cy3-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGCGAGGGTCCAATAC
Gint4.T UGUCGUGGGGCAUCGAGUAAAUGCAAUUCGACAAAAAAA