Skip to main content

Table 1 Primer sequence

From: Restored microRNA-326-5p Inhibits Neuronal Apoptosis and Attenuates Mitochondrial Damage via Suppressing STAT3 in Cerebral Ischemia/Reperfusion Injury

Gene Primers
miR-326-5p Reverse transcription
  CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTTCACAAA
  Forward: 5′-CAGGGCCTTTGTGAA-3’
  Reverse: 5′-TCAACTGGTGTCGTGG-3’
  Reverse transcription:
  CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAAAATATG
RNU6B Forward: 5′-CAAATTCGTGAAGCGTT-3’
  Reverse: 5′-TGGTGTCGTGGAGTCG-3’
Bax Forward: 5′-AAGAAGCTGAGCGAGTGTCT-3’
  Reverse: 5′- CAAAGATGGTCACTGTCTGC-3’
Bcl-2 Forward: 5′- GAGCGTCAACAGGGAGATGT-3’
  Reverse: 5′- CAGCCAGGAGAAATCAAACAG-3’
STAT3 Forward: 5′-AAACTGCTTGCCTTGACCAC-3’
  Reverse: 5′-CGCCTTGCCTTCCTAAATAC-3’
GAPDH Forward: 5′-TTCCTACCCCCAATGTATCCG-3’
  Reverse: 5′-CCACCCTGTTGCTGTAGCCATA-3’
  1. miR-326-5p, microRNA-326-5p; STAT3, Signal transducer and activator of transcription-3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase